Table 4. qPCR primer sequences
EV‐YF15′‐GGCTGGTCCGATGGTTAGTG‐3′5′‐ACTTTAGTGACACTAATGTT‐3′
HPRT5′‐GAGAGATCATCTCCACCAAT‐3′5′‐ ACTTTAGTGACACTAATGTT‐3′
U65′‐GCTTCGGCAGCACATATACTAAAAT‐3′5′‐CGCTTCACGAATTTGCGTGTCAT‐3′